pLD003-pCMV-APOBEC-Cas9(D10A)-rPB(8kD)
(Plasmid
#165445)
-
PurposeExpresses ACX, rPB(8kD) in mammalian cells
-
Depositing Lab
-
Depositing OrganizationGenome Institute of Singapore, A*STAR Research Entities
Located in Singapore -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 165445 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 165445-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 165445-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneCMV
-
Backbone manufacturerorigene
- Backbone size w/o insert (bp) 3399
- Total vector size (bp) 8541
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAPOBEC-nCas9-rPB(8kD)
-
Alt namerAPOBEC1-XTEN-Cas9n-rPolB(8kD)-NLS
-
SpeciesR. norvegicus (rat), Synthetic; Streptococcus pyogenes
-
Insert Size (bp)5142
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer tagaaggcacagtcgagg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 165445-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 165445-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLD003-pCMV-APOBEC-Cas9(D10A)-rPB(8kD) was a gift from Wei Leong Chew (Addgene plasmid # 165445 ; http://n2t.net/addgene:165445 ; RRID:Addgene_165445) -
For your References section:
Programmable C:G to G:C genome editing with CRISPR-Cas9-directed base excision repair proteins. Chen L, Park JE, Paa P, Rajakumar PD, Prekop HT, Chew YT, Manivannan SN, Chew WL. Nat Commun. 2021 Mar 2;12(1):1384. doi: 10.1038/s41467-021-21559-9. 10.1038/s41467-021-21559-9 PubMed 33654077