Level 1 P3 TaU6 guide acceptor
(Plasmid
#165599)
-
PurposeGoldenGate (MoClo) Level 1 Position 3 TaU6 guide acceptor plasmid
-
Depositing Labs
-
Depositing OrganizationJohn Innes Centre
Located in United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 165599 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 165599-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 165599-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepUC
-
Vector typeCRISPR, Synthetic Biology ; sgRNA acceptor with LacZ Blue/white screening
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTaU6 promoter::LacZ::sgRNA scaffold
-
gRNA/shRNA sequenceGTGAGACCGCAGCTGGCACG
-
SpeciesSynthetic
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 165599-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 165599-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Level 1 P3 TaU6 guide acceptor was a gift from Wendy Harwood & John Innes Centre - Wheat Transformation and Genome Editing (Addgene plasmid # 165599 ; http://n2t.net/addgene:165599 ; RRID:Addgene_165599) -
For your References section:
CRISPR-Cas9 Based Genome Editing in Wheat. Smedley MA, Hayta S, Clarke M, Harwood WA. Curr Protoc. 2021 Mar;1(3):e65. doi: 10.1002/cpz1.65. 10.1002/cpz1.65 PubMed 33687760