pGG426_UV5
(Plasmid #165608)

• Purpose: Vector for expression of the SpCas9 VRKG variant with sgRNA in E. coli: lacUV5-VRKG(SpCas9, D1135V/S1136R/D1332K/R1333G) and UV5-sgRNA (hEGFP spacer)
• Depositing Lab: Marcus Noyes
• Publication: Goldberg et al Nat Commun. 2021 Jan 13;12(1):349. doi: 10.1038/s41467-020-20650-x.

Backbone

• Vector backbone: pGG426
• Backbone manufacturer: Marcus Noyes Lab
• Vector type: Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Growth instructions: Low or intermediate copy number is expected (high copy is suppressed by the intact rop gene on this plasmid).
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: lacUV5 driving Streptococcus pyogenes Cas9 VRKG(D1135V/S1136R/D1332K/R1333G) and hEGFP-sgRNA
• Mutation: D1135V, S1136R, D1332K and R1333G mutations in SpCas9
• Promoter: lacUV5 driving Cas9 VRKG and UV5 driving sgRNA

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: n/a
• 3′ sequencing primer: ATTCTTCCGACGTGTATACCTTC

Resource Information

• Supplemental Documents:
  • pGG426_UV5.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry