His6-TEV-Venus-pBluescript
(Plasmid #166756)

• Purpose: For purification of Venus fluorophore
• Depositing Lab: David Andrews
• Publication: Osterlund et al Sci Adv. 2022 Apr 22;8(16):eabm7375. doi: 10.1126/sciadv.abm7375. Epub 2022 Apr 20.

Backbone

• Vector backbone: pBluescript
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Venus
• Species: Synthetic
• Promoter: T7
• Tag / Fusion Protein:
  • 6x Histidine tag, and TEV protease site (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCAATTAACCCTCACTAAAGG

Resource Information

• Supplemental Documents:
  • His-TEV-Venus-pBluescript_GeneBank.gb
• A portion of this plasmid was derived from a plasmid made by: Venus construct received from Dr. Ray Truant (McMaster University). Venus was cut and pasted into pBluescript backbone.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Plasmid can be used to express monomeric Venus fluorophore in bacteria. We used E.coli BL21-AI (Arabinose induction) for protein production, induced 5h at 30oC. Purify protein via Nickel column chromatography. When compared with EYFP, Venus fluorophore contains the following mutations: F46L, F64L, M153T, V163A and S175G. This Venus protein contains an F224R mutation to make it monomeric.