pET28a-ammC1
(Plasmid
#167816)
-
PurposeExpresses His6-tagged AmmC1 in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 167816 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET28a
-
Backbone manufacturerTwist Biosciences
- Backbone size w/o insert (bp) 5369
- Total vector size (bp) 7214
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAmmC1
-
Alt nameAmmC1 codon optimized for E. coli expression
-
SpeciesSynthetic
-
Insert Size (bp)1845
- Promoter T7
-
Tag
/ Fusion Protein
- His6 (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byTwist Bioscience
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a-ammC1 was a gift from Wilfred van der Donk (Addgene plasmid # 167816 ; http://n2t.net/addgene:167816 ; RRID:Addgene_167816) -
For your References section:
A biosynthetic pathway to aromatic amines that uses glycyl-tRNA as nitrogen donor. Daniels PN, Lee H, Splain RA, Ting CP, Zhu L, Zhao X, Moore BS, van der Donk WA. Nat Chem. 2022 Jan;14(1):71-77. doi: 10.1038/s41557-021-00802-2. Epub 2021 Nov 1. 10.1038/s41557-021-00802-2 PubMed 34725492
