SOX2 KO (T2A-H2B-EGFP)
(Plasmid
#167969)
-
PurposeSOX2 CDS replacement with T2A-H2B-EGFP
-
Depositing Lab
-
Depositing OrganizationGurdon Institute
Located in United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 167969 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 167969-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 167969-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepUC57
-
Vector typeMammalian Expression, CRISPR ; Donor Template
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSRY-Box Transcription Factor 2
-
SpeciesH. sapiens (human)
-
Mutationhomology arms contain point mutations to disrupt crRNA binding sites used and point mutations specific to WTC genome
-
Entrez GeneSOX2 (a.k.a. ANOP3, MCOPS3)
-
Tag
/ Fusion Protein
- H2B-EGFP
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gatgtgctgcaaggcgattaag
- 3′ sequencing primer ctcgtatgttgtgtggaattg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.05.04.076067v2 for bioRxiv preprint.
DNA (Catalog # 167969-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 167969-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SOX2 KO (T2A-H2B-EGFP) was a gift from Emma Rawlins (Addgene plasmid # 167969 ; http://n2t.net/addgene:167969 ; RRID:Addgene_167969) -
For your References section:
A functional genetic toolbox for human tissue-derived organoids. Sun D, Evans L, Perrone F, Sokleva V, Lim K, Rezakhani S, Lutolf M, Zilbauer M, Rawlins EL. eLife. 2021 Oct 6;10. pii: 67886. doi: 10.7554/eLife.67886. 10.7554/eLife.67886 PubMed 34612202