Skip to main content

Tol2-LyzC-GFP-U6ac-ctrl-guides
(Plasmid #168240)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 168240 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 168240-D50 50 μg of DNA in Tris buffer $495
DNA 168240-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    R4R3 pDest
  • Vector type
    CRISPR
  • Selectable markers
    LyzC-GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    control sgRNAs
  • gRNA/shRNA sequence
    agagacggtcgacagtctgcagtgtcgtctctc

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Reference for p3e-U6a-U6c-control-guides used for gateway cloning:
Neutrophil-specific knockout demonstrates a role for mitochondria in regulating neutrophil motility in zebrafish. Zhou W, Cao L, Jeffries J, Zhu X, Staiger CJ, Deng Q. Dis Model Mech. 2018 Mar 28;11(3). pii: dmm.033027. doi: 10.1242/dmm.033027. 10.1242/dmm.033027

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Tol2-LyzC-GFP-U6ac-ctrl-guides was a gift from Qing Deng (Addgene plasmid # 168240 ; http://n2t.net/addgene:168240 ; RRID:Addgene_168240)
  • For your References section:

    A robust and flexible CRISPR/Cas9-based system for neutrophil-specific gene inactivation in zebrafish. Wang Y, Hsu AY, Walton EM, Park SJ, Syahirah R, Wang T, Zhou W, Ding C, Lemke AP, Zhang G, Tobin DM, Deng Q. J Cell Sci. 2021 Apr 15;134(8). pii: 237799. doi: 10.1242/jcs.258574. Epub 2021 Apr 22. 10.1242/jcs.258574 PubMed 33722979