Tol2-LyzC-GFP-U6ac-cdk2-guides
(Plasmid
#168250)
-
Purpose"neutrophil specific GFP with ubiquitous cdk2 sgRNAs"
-
Depositing Lab
-
Depositing OrganizationPurdue University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 168250 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 168250-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 168250-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneR4R3 pDest
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namecdk2 sgRNAs
-
gRNA/shRNA sequenceagagacggtcgacagtctgcagtgtcgtctctc
-
SpeciesD. rerio (zebrafish)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 168250-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 168250-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Tol2-LyzC-GFP-U6ac-cdk2-guides was a gift from Qing Deng (Addgene plasmid # 168250 ; http://n2t.net/addgene:168250 ; RRID:Addgene_168250) -
For your References section:
A robust and flexible CRISPR/Cas9-based system for neutrophil-specific gene inactivation in zebrafish. Wang Y, Hsu AY, Walton EM, Park SJ, Syahirah R, Wang T, Zhou W, Ding C, Lemke AP, Zhang G, Tobin DM, Deng Q. J Cell Sci. 2021 Apr 15;134(8). pii: 237799. doi: 10.1242/jcs.258574. Epub 2021 Apr 22. 10.1242/jcs.258574 PubMed 33722979