pBAD-wtBlc
(Plasmid #168255)

• Purpose: wild‐type E. coli lipocalin Blc without signal peptide
• Depositing Lab: Jens Meiler
• Publication: Bozhanova et al FEBS Lett. 2021 Jan;595(2):206-219. doi: 10.1002/1873-3468.14001. Epub 2020 Dec 3.

Backbone

• Vector backbone: pBAD
• Backbone size w/o insert (bp): 3958
• Total vector size (bp): 4492
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Lipocalin Blc
• Species: E. coli
• Insert Size (bp): 534
• GenBank ID: NC_000913.3
• Promoter: araBAD
• Tag / Fusion Protein:
  • His-tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: ATGCCATAGCATTTTTATCC
• 3′ sequencing primer: GATTTAATCTGTATCAGG

Resource Information

• Supplemental Documents:
  • pBAD-wtBlc.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry