pET11a-Z-N-wtBlc
(Plasmid #168258)

• Purpose: N-fragment of the wtBlc‐split‐Zip protein. This plasmid needs to be co-transformed with Plasmid 168256: pMRBad-Z-C-wtBlc to obtain wtBlc‐split-Zip protein
• Depositing Lab: Jens Meiler
• Publication: Bozhanova et al FEBS Lett. 2021 Jan;595(2):206-219. doi: 10.1002/1873-3468.14001. Epub 2020 Dec 3.

Backbone

• Vector backbone: pET11a
• Backbone size w/o insert (bp): 5641
• Total vector size (bp): 6076
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: N-fragment of wtBlc + Leucine Zipper
• Species: Synthetic
• Insert Size (bp): 435
• Promoter: T7
• Tag / Fusion Protein:
  • His-tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: CTAGTTATTGCTCAGCGGTG

Resource Information

• Supplemental Documents:
  • pet11a-z-n-wtblc.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry