pB[nos-Cas9 PUb-ZsGreen]
(Plasmid #169011)

• Purpose: For germline transformation. Expresses Cas9 in germ cells and ZsGreen marker in all cells.
• Depositing Lab: Max Scott
• Publication: Kandul et al CRISPR J. 2021 Oct;4(5):739-751. doi: 10.1089/crispr.2021.0032.

Backbone

• Vector backbone: pB[PUb-ZsGreen]
• Total vector size (bp): 7627
• Vector type: Insect Expression ; piggyBac

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cas9
• Species: Streptococcus pyogenes
• Insert Size (bp): 4163
• Promoter: Drosophila melanogaster nanos

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HapI (destroyed during cloning)
• 3′ cloning site: PspOMI (not destroyed)
• 5′ sequencing primer: CGCCAAAACCAAATCTGCC
• 3′ sequencing primer: GCTTGTCAATGCGGTAAGTG

Resource Information

• Supplemental Documents:
  • pB[nos-Cas9 PUb-ZsGreen].gb
• A portion of this plasmid was derived from a plasmid made by: nos_cas9 from NIG-Fly, Japan. We moved the nos-Cas9 gene into a piggyBac vector

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • National Institute of Genetics Limited Use Label License for Tol2 System
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry