pET11a_3xFlag-nsp10 (SARS-CoV-2)
(Plasmid
#169157)
-
PurposeTo express SARS-CoV-2 nsp10 in E. coli
-
Depositing Lab
-
Depositing OrganizationFrancis Crick Institute
Located in United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 169157 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepET11a
- Total vector size (bp) 6142
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert name3xFlag-nsp5CS[VRLQ]-nsp10
-
Alt nameEc F-nsp10
-
Alt nameSARS-CoV-2 nsp10 cofactor
-
SpeciesSynthetic; SARS-CoV-2
-
MutationCodon optimised for E. coli
-
GenBank ID
-
Entrez GeneORF1ab (a.k.a. GU280_gp01)
- Promoter T7
-
Tags
/ Fusion Proteins
- 3xFlag (N terminal on insert)
- nsp5CS[VRLQ]: predicted nsp5 protease cleavage site found between nsp9 and nsp10 (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGCGACTCCTGCATTAG
- 3′ sequencing primer TCCTTTCGGGCTTTGTTAGCAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
We have included the predicted cleavage site for nsp5 found between nsp9 and nsp10 (VRLQ) between the 3xFlag tag and nsp10 in this construct that should allow a purified nsp5 protease to cleave-out the 3xFlag tag similarly to what might happen in cells.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET11a_3xFlag-nsp10 (SARS-CoV-2) was a gift from John Diffley (Addgene plasmid # 169157 ; http://n2t.net/addgene:169157 ; RRID:Addgene_169157) -
For your References section:
Identifying SARS-CoV-2 antiviral compounds by screening for small molecule inhibitors of nsp14/nsp10 exoribonuclease. Canal B, McClure AW, Curran JF, Wu M, Ulferts R, Weissmann F, Zeng J, Bertolin AP, Milligan JC, Basu S, Drury LS, Deegan TD, Fujisawa R, Roberts EL, Basier C, Labib K, Beale R, Howell M, Diffley JFX. Biochem J. 2021 Jul 16;478(13):2445-2464. doi: 10.1042/BCJ20210198. 10.1042/BCJ20210198 PubMed 34198326