Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pET11a_3xFlag-nsp14 (SARS-CoV-2)
(Plasmid #169159)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 169159 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    3xFlag-nsp5CS[VATLQ]-nsp14
  • Alt name
    Ec F-nsp14
  • Alt name
    SARS-CoV-2 nsp14 exonuclease/methyltransferase
  • Species
    SARS-CoV-2
  • Mutation
    Codon optimised for E. coli
  • GenBank ID
  • Entrez Gene
    ORF1ab (a.k.a. GU280_gp01)
  • Promoter T7
  • Tags / Fusion Proteins
    • 3xFlag (N terminal on insert)
    • nsp5CS[VATLQ]: predicted nsp5 protease cleavage site found between nsp13 and nsp14

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATGCGACTCCTGCATTAG
  • 3′ sequencing primer TCCTTTCGGGCTTTGTTAGCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

We have included the predicted cleavage site for nsp5 found between nsp13 and nsp14 (VATLQ) between the 3xFlag tag and nsp14 in this construct, which should allow a purified nsp5 protease to cleave-out the 3xFlag tag similarly to what might happen in cells.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET11a_3xFlag-nsp14 (SARS-CoV-2) was a gift from John Diffley (Addgene plasmid # 169159 ; http://n2t.net/addgene:169159 ; RRID:Addgene_169159)
  • For your References section:

    Identifying SARS-CoV-2 antiviral compounds by screening for small molecule inhibitors of nsp14/nsp10 exoribonuclease. Canal B, McClure AW, Curran JF, Wu M, Ulferts R, Weissmann F, Zeng J, Bertolin AP, Milligan JC, Basu S, Drury LS, Deegan TD, Fujisawa R, Roberts EL, Basier C, Labib K, Beale R, Howell M, Diffley JFX. Biochem J. 2021 Jul 16;478(13):2445-2464. doi: 10.1042/BCJ20210198. 10.1042/BCJ20210198 PubMed 34198326