-
PurposeUbiquitous expression of mtON in C. elegans
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 158967 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFH6.II (pPD95.81 with a modified multi‐cloning site)
- Backbone size w/o insert (bp) 3527
- Total vector size (bp) 6367
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeft-3p::mitofilin::Mac::GFP::unc-54 3'UTR
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)3509
- Promoter eft-3
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ACCGTCCGCACTCTTCTTAC
- 3′ sequencing primer TTGACACCAGACAAGTTGGTAATGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBJB20 - eft-3p::mitofilin::Mac::GFP::unc-54 3'UTR was a gift from Andrew Wojtovich (Addgene plasmid # 158967 ; http://n2t.net/addgene:158967 ; RRID:Addgene_158967) -
For your References section:
Optogenetic control of mitochondrial protonmotive force to impact cellular stress resistance. Berry BJ, Trewin AJ, Milliken AS, Baldzizhar A, Amitrano AM, Lim Y, Kim M, Wojtovich AP. EMBO Rep. 2020 Apr 3;21(4):e49113. doi: 10.15252/embr.201949113. Epub 2020 Feb 11. 10.15252/embr.201949113 PubMed 32043300