Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBJB20 - eft-3p::mitofilin::Mac::GFP::unc-54 3'UTR
(Plasmid #158967)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 158967 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pFH6.II (pPD95.81 with a modified multi‐cloning site)
  • Backbone size w/o insert (bp) 3527
  • Total vector size (bp) 6367
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eft-3p::mitofilin::Mac::GFP::unc-54 3'UTR
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    3509
  • Promoter eft-3
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ACCGTCCGCACTCTTCTTAC
  • 3′ sequencing primer TTGACACCAGACAAGTTGGTAATGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBJB20 - eft-3p::mitofilin::Mac::GFP::unc-54 3'UTR was a gift from Andrew Wojtovich (Addgene plasmid # 158967 ; http://n2t.net/addgene:158967 ; RRID:Addgene_158967)
  • For your References section:

    Optogenetic control of mitochondrial protonmotive force to impact cellular stress resistance. Berry BJ, Trewin AJ, Milliken AS, Baldzizhar A, Amitrano AM, Lim Y, Kim M, Wojtovich AP. EMBO Rep. 2020 Apr 3;21(4):e49113. doi: 10.15252/embr.201949113. Epub 2020 Feb 11. 10.15252/embr.201949113 PubMed 32043300