pK27Sumo_His-SUMO-PLpro (nsp3) (SARS-CoV-2)
(Plasmid
#169193)
-
PurposeTo express SARS-CoV-2 Papain-like protease in E. coli
-
Depositing Lab
-
Depositing OrganizationFrancis Crick Institute
Located in the United Kingdom of Great Britain and Northern Ireland -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 169193 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepK27SUMO
- Total vector size (bp) 5239
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsT5 promoter inducible with IPTG
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name14His-SUMO-nsp3_E746-K1060 (pp1ab_E1564-K1878)
-
Alt nameHis-SUMO-PLpro
-
Alt nameSARS-CoV-2 Papain-like protease
-
SpeciesSynthetic; SARS-CoV-2
-
MutationCodon optimised for E. coli
-
Entrez GeneORF1ab (a.k.a. GU280_gp01)
- Promoter T5
-
Tag
/ Fusion Protein
- 14His-SUMO (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAAGCTGATCAGACCCCTGA
- 3′ sequencing primer CCAGATGGAGTTCTGAGGTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pK27Sumo_His-SUMO-PLpro (nsp3) (SARS-CoV-2) was a gift from John Diffley (Addgene plasmid # 169193 ; http://n2t.net/addgene:169193 ; RRID:Addgene_169193) -
For your References section:
Identifying SARS-CoV-2 antiviral compounds by screening for small molecule inhibitors of Nsp3 papain-like protease. Lim CT, Tan KW, Wu M, Ulferts R, Armstrong LA, Ozono E, Drury LS, Milligan JC, Zeisner TU, Zeng J, Weissmann F, Canal B, Bineva-Todd G, Howell M, O'Reilly N, Beale R, Kulathu Y, Labib K, Diffley JFX. Biochem J. 2021 Jul 16;478(13):2517-2531. doi: 10.1042/BCJ20210244. 10.1042/BCJ20210244 PubMed 34198325