pET11a_His-TEV-PLpro (nsp3) (SARS-CoV-2)
(Plasmid #169192)

• Purpose: To express SARS-CoV-2 Papain-like protease in E. coli
• Depositing Lab: John Diffley
• Publication: Lim et al Biochem J. 2021 Jul 16;478(13):2517-2531. doi: 10.1042/BCJ20210244.

Backbone

• Vector backbone: pET11a
  (Search Vector Database)
• Total vector size (bp): 6634
• Vector type: Unspecified

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: 6His-TEV-nsp3_E746-K1060 (pp1ab_E1564-K1878)
• Alt name: His-TEV-PLpro
• Alt name: SARS-CoV-2 Papain-like protease
• Species: Synthetic; SARS-CoV-2
• Mutation: Codon optimised for E. coli
• Entrez Gene: ORF1ab (a.k.a. GU280_gp01)
• Promoter: T7
• Tag / Fusion Protein:
  • 6His-TEV (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATGCGACTCCTGCATTAG
• 3′ sequencing primer: TCCTTTCGGGCTTTGTTAGCAG

Resource Information

• Supplemental Documents:
  • pET11a_His-TEV-PLpro (SARS-CoV-2)_169192.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry