Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #87741)


Item Catalog # Description Quantity Price (USD)
Plasmid 87741 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Kitagawa et al. (PMID:16769691)
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    T4 DNA ligase
  • Entrez Gene
    30 (a.k.a. T4p202, lig)
  • Promoter T5-lac
  • Tag / Fusion Protein
    • 6xHis (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer pCA24N.for (GATAACAATTTCACACAGAATTCATTAAAGAG)
  • 3′ sequencing primer pCA24N.rev2 — 5'-CAAATCCAGATGGAGTTCTGAGG-3'
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Previously, we PCR amplified the lig gene from pRBL (Ren et al., 1997; PMID: 9305776).
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

For complete cloning information, please see the paper's supplement.
For expression, E. coli DH5a-E cells harbouring each expression vector were grown at 37°C in LB broth containing chloramphenicol (34 µ, to OD600 ~ 0.6. IPTG (0.4 mM, final concentration) was added as an inducer, and protein over-expression was at 28°C for 16-18 h.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCA24N-ligase was a gift from Wayne Patrick (Addgene plasmid # 87741 ; ; RRID:Addgene_87741)
  • For your References section:

    Engineered DNA ligases with improved activities in vitro. Wilson RH, Morton SK, Deiderick H, Gerth ML, Paul HA, Gerber I, Patel A, Ellington AD, Hunicke-Smith SP, Patrick WM. Protein Eng Des Sel. 2013 Jul;26(7):471-8. doi: 10.1093/protein/gzt024. Epub 2013 Jun 10. 10.1093/protein/gzt024 PubMed 23754529