pLIB_3xFlag-His-PLpro (nsp3) (SARS-CoV-2)
(Plasmid
#169194)
-
PurposeBaculoviral transfer vector to express SARS-CoV-2 papain-like protease domain (nsp3) in insect cells
-
Depositing Lab
-
Depositing OrganizationFrancis Crick Institute
Located in United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 169194 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLIB (biGBac)
-
Vector typeInsect Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name3xFlag-His6-PLpro
-
Alt name3xFlag-His6-nsp3_746-1060 (pp1ab_1564-1878)
-
Alt name3FH-PLpro
-
Alt nameSARS-CoV-2 PLpro (nsp3)
-
SpeciesSynthetic; SARS-CoV-2
-
MutationCodon optimised for insect cells (Spodoptera frugiperda)
-
Entrez GeneORF1ab (a.k.a. GU280_gp01)
- Promoter Polyhedrin
-
Tag
/ Fusion Protein
- 3xFlag-His6 (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAACAGGTTGAACTGCTGATC
- 3′ sequencing primer GGTGTAGCGTCGTAAGCTAATAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Baculovirus generation using Tn7 transposition (Bac-to-Bac).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLIB_3xFlag-His-PLpro (nsp3) (SARS-CoV-2) was a gift from John Diffley (Addgene plasmid # 169194 ; http://n2t.net/addgene:169194 ; RRID:Addgene_169194) -
For your References section:
Identifying SARS-CoV-2 antiviral compounds by screening for small molecule inhibitors of Nsp3 papain-like protease. Lim CT, Tan KW, Wu M, Ulferts R, Armstrong LA, Ozono E, Drury LS, Milligan JC, Zeisner TU, Zeng J, Weissmann F, Canal B, Bineva-Todd G, Howell M, O'Reilly N, Beale R, Kulathu Y, Labib K, Diffley JFX. Biochem J. 2021 Jul 16;478(13):2517-2531. doi: 10.1042/BCJ20210244. 10.1042/BCJ20210244 PubMed 34198325