-
PurposeExpresses machinery necessary for selenocysteine incorporation at UAG codons
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 163148 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBAD-myc-HisA
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 3500
- Total vector size (bp) 8635
-
Modifications to backboneRSF origin and kanamycin resistance were taken from pRSF-Duet1 and used to replace the pBR322 origin and ampicillin resistance of pBAD-myc-HisA
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameallo-tRNA UTu2D
-
SpeciesSynthetic
-
Insert Size (bp)90
-
GenBank ID
- Promoter araBAD
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namethioredoxin
-
Alt nameTrx1
-
SpeciesTreponema denticola
-
Insert Size (bp)324
-
MutationCysteine 32 switched to Selenocysteine (UAG)
-
GenBank IDNC_002967
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GCGGCTATTTAACGACCCTG
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameSelenophosphate synthase
-
Alt nameSelD
-
SpeciesAeromonas salmonicida
-
Insert Size (bp)1038
-
Mutationstarts with GUG instead of AUG
-
GenBank IDNF_002098
- Promoter native As SelD promoter
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer CTACCACGGTGCCCAAAAGTC
- 3′ sequencing primer GCATTTTCGACAGGCTATTG
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameSelenocysteine synthase
-
Alt nameSelA
-
SpeciesAeromonas salmonicida
-
Insert Size (bp)1488
-
Mutationchanged initiator AUG to GUG then the following amino acids P2T, L69F, Q72S, and C173V
-
GenBank IDNF_003308
- Promoter EM7
Cloning Information for Gene/Insert 4
- Cloning method Gibson Cloning
- 5′ sequencing primer CAGGGCATTATGCCACAAG
- 3′ sequencing primer GAAGTGGATCGTCTGGTGAC
- (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert nameCysteine desulfurase
-
Alt nameSufS
-
SpeciesEscherichia coli
-
Insert Size (bp)1221
-
MutationCysteine 364 to Alanine
-
GenBank IDNF_006791
- Promoter native Ec SufS promoter
Cloning Information for Gene/Insert 5
- Cloning method Gibson Cloning
- 5′ sequencing primer GATTCGGGCTGACTGTGAGAG
- 3′ sequencing primer CTCGGTGAGTTTTCTCCTTC
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For additional information and the protocol for using this plasmid, please see:
https://doi.org/10.1002/cpz1.54
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSecUAG-Evol2 was a gift from Dieter Söll (Addgene plasmid # 163148 ; http://n2t.net/addgene:163148 ; RRID:Addgene_163148) -
For your References section:
A Facile Method for Producing Selenocysteine-Containing Proteins. Mukai T, Sevostyanova A, Suzuki T, Fu X, Soll D. Angew Chem Int Ed Engl. 2018 Jun 11;57(24):7215-7219. doi: 10.1002/anie.201713215. Epub 2018 May 9. 10.1002/anie.201713215 PubMed 29631320