Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pSecUAG-Evol2
(Plasmid #163148)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 163148 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBAD-myc-HisA
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 3500
  • Total vector size (bp) 8635
  • Modifications to backbone
    RSF origin and kanamycin resistance were taken from pRSF-Duet1 and used to replace the pBR322 origin and ampicillin resistance of pBAD-myc-HisA
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    allo-tRNA UTu2D
  • Species
    Synthetic
  • Insert Size (bp)
    90
  • GenBank ID
  • Promoter araBAD

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    thioredoxin
  • Alt name
    Trx1
  • Species
    Treponema denticola
  • Insert Size (bp)
    324
  • Mutation
    Cysteine 32 switched to Selenocysteine (UAG)
  • GenBank ID
    NC_002967

Cloning Information for Gene/Insert 2

Gene/Insert 3

  • Gene/Insert name
    Selenophosphate synthase
  • Alt name
    SelD
  • Species
    Aeromonas salmonicida
  • Insert Size (bp)
    1038
  • Mutation
    starts with GUG instead of AUG
  • GenBank ID
    NF_002098
  • Promoter native As SelD promoter

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTACCACGGTGCCCAAAAGTC
  • 3′ sequencing primer GCATTTTCGACAGGCTATTG
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    Selenocysteine synthase
  • Alt name
    SelA
  • Species
    Aeromonas salmonicida
  • Insert Size (bp)
    1488
  • Mutation
    changed initiator AUG to GUG then the following amino acids P2T, L69F, Q72S, and C173V
  • GenBank ID
    NF_003308
  • Promoter EM7

Cloning Information for Gene/Insert 4

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CAGGGCATTATGCCACAAG
  • 3′ sequencing primer GAAGTGGATCGTCTGGTGAC
  • (Common Sequencing Primers)

Gene/Insert 5

  • Gene/Insert name
    Cysteine desulfurase
  • Alt name
    SufS
  • Species
    Escherichia coli
  • Insert Size (bp)
    1221
  • Mutation
    Cysteine 364 to Alanine
  • GenBank ID
    NF_006791
  • Promoter native Ec SufS promoter

Cloning Information for Gene/Insert 5

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GATTCGGGCTGACTGTGAGAG
  • 3′ sequencing primer CTCGGTGAGTTTTCTCCTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For additional information and the protocol for using this plasmid, please see:
https://doi.org/10.1002/cpz1.54

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSecUAG-Evol2 was a gift from Dieter Söll (Addgene plasmid # 163148 ; http://n2t.net/addgene:163148 ; RRID:Addgene_163148)
  • For your References section:

    A Facile Method for Producing Selenocysteine-Containing Proteins. Mukai T, Sevostyanova A, Suzuki T, Fu X, Soll D. Angew Chem Int Ed Engl. 2018 Jun 11;57(24):7215-7219. doi: 10.1002/anie.201713215. Epub 2018 May 9. 10.1002/anie.201713215 PubMed 29631320