pSecUAG-Evol2
(Plasmid #163148)

• Purpose: Expresses machinery necessary for selenocysteine incorporation at UAG codons
• Depositing Lab: Dieter Söll
• Publication: Mukai et al Angew Chem Int Ed Engl. 2018 Jun 11;57(24):7215-7219. doi: 10.1002/anie.201713215. Epub 2018 May 9.

Backbone

• Vector backbone: pBAD-myc-HisA
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 3500
• Total vector size (bp): 8635
• Modifications to backbone: RSF origin and kanamycin resistance were taken from pRSF-Duet1 and used to replace the pBR322 origin and ampicillin resistance of pBAD-myc-HisA
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: allo-tRNA UTu2D
• Species: Synthetic
• Insert Size (bp): 90
• GenBank ID:
• Promoter: araBAD

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATGCCATAGCATTTTTATCC

Gene/Insert 2

• Gene/Insert name: thioredoxin
• Alt name: Trx1
• Species: Treponema denticola
• Insert Size (bp): 324
• Mutation: Cysteine 32 switched to Selenocysteine (UAG)
• GenBank ID: NC_002967

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCGGCTATTTAACGACCCTG

Gene/Insert 3

• Gene/Insert name: Selenophosphate synthase
• Alt name: SelD
• Species: Aeromonas salmonicida
• Insert Size (bp): 1038
• Mutation: starts with GUG instead of AUG
• GenBank ID: NF_002098
• Promoter: native As SelD promoter

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTACCACGGTGCCCAAAAGTC
• 3′ sequencing primer: GCATTTTCGACAGGCTATTG

Gene/Insert 4

• Gene/Insert name: Selenocysteine synthase
• Alt name: SelA
• Species: Aeromonas salmonicida
• Insert Size (bp): 1488
• Mutation: changed initiator AUG to GUG then the following amino acids P2T, L69F, Q72S, and C173V
• GenBank ID: NF_003308
• Promoter: EM7

Cloning Information for Gene/Insert 4

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CAGGGCATTATGCCACAAG
• 3′ sequencing primer: GAAGTGGATCGTCTGGTGAC

Gene/Insert 5

• Gene/Insert name: Cysteine desulfurase
• Alt name: SufS
• Species: Escherichia coli
• Insert Size (bp): 1221
• Mutation: Cysteine 364 to Alanine
• GenBank ID: NF_006791
• Promoter: native Ec SufS promoter

Cloning Information for Gene/Insert 5

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GATTCGGGCTGACTGTGAGAG
• 3′ sequencing primer: CTCGGTGAGTTTTCTCCTTC

Resource Information

• Supplemental Documents:
  • pSecUAG-Evol2.gb
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For additional information and the protocol for using this plasmid, please see:
https://doi.org/10.1002/cpz1.54