pUltra-sY
(Plasmid #82417)

• Purpose: Expresses Mj aaRS for sulfotyrosine and Mj tRNA for decoding UAG codons
• Depositing Lab: Chang Liu
• Publication: Schwessinger et al Integr Biol (Camb). 2016 Apr 18;8(4):542-5. doi: 10.1039/c5ib00232j. Epub 2015 Nov 27.

Backbone

• Vector backbone: pUltra
• Backbone size w/o insert (bp): 4056
• Total vector size (bp): 4977
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): DH5alpha
• Growth instructions: Pick medium/small colonies from LB Agar plates. The SS320 and C321.ΔA (Addgene catalog ID: 48998) strains were used in the associated publication.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Methanococcus jannaschii aaRS for sulfotyrosine
• Alt name: STyrRS
• Species: methanococcus jannaschii
• Insert Size (bp): 921
• Mutation: Tyr32Leu, Leu65Pro, Asp158Gly, Ile159Cys, Leu162Lys
• Promoter: tacI

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: TCGTATAATGTGTGGAATTG
• 3′ sequencing primer: TGATGACTCTCCAGAAGAGA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Peter Schultz
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry