TVBB N-term-mTurquoise2
(Plasmid
#169222)
-
PurposeTargeting vector backbone to support a knock-in of mTurquoise2-Linker at the N-terminus of a target locus
-
Depositing Lab
-
Depositing OrganizationUniversity Medical Centre Utrecht
Located in the Netherlands -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 169222 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 169222-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 169222-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneMinimalistic Amp + ColE1 backbone
- Backbone size w/o insert (bp) 1969
- Total vector size (bp) 2774
-
Modifications to backbonePCR amplified minimalistic backbone segment
-
Vector typeTargeting vector backbone
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsGrow at 30C for a few hours after overnight growth at 37C to amplify the plasmid copy number
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameDouble SapI flanked mTurquoise2
-
SpeciesSynthetic
-
Insert Size (bp)805
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer caaataggggttccgcgcac
- 3′ sequencing primer ttaccgcctttgagtgagctga
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 169222-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 169222-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TVBB N-term-mTurquoise2 was a gift from Hugo Snippert (Addgene plasmid # 169222 ; http://n2t.net/addgene:169222 ; RRID:Addgene_169222) -
For your References section:
Efficient and error-free fluorescent gene tagging in human organoids without double-strand DNA cleavage. Bollen Y, Hageman JH, van Leenen P, Derks LLM, Ponsioen B, Buissant des Amorie JR, Verlaan-Klink I, van den Bos M, Terstappen LWMM, van Boxtel R, Snippert HJG. PLoS Biol. 2022 Jan 28;20(1):e3001527. doi: 10.1371/journal.pbio.3001527. 10.1371/journal.pbio.3001527 PubMed 35089911