Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

TVBB N-term-mNeongreen
(Plasmid #169226)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 169226 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Minimalistic Amp + ColE1 backbone
  • Backbone size w/o insert (bp) 1969
  • Total vector size (bp) 2765
  • Modifications to backbone
    PCR amplified minimalistic backbone segment
  • Vector type
    Targeting vector backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Grow at 30C for a few hours after overnight growth at 37C to amplify the plasmid copy number
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Double SapI flanked mNeongreen
  • Species
    Synthetic
  • Insert Size (bp)
    796

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer caaataggggttccgcgcac
  • 3′ sequencing primer ttaccgcctttgagtgagctga
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TVBB N-term-mNeongreen was a gift from Hugo Snippert (Addgene plasmid # 169226 ; http://n2t.net/addgene:169226 ; RRID:Addgene_169226)
  • For your References section:

    Efficient and error-free fluorescent gene tagging in human organoids without double-strand DNA cleavage. Bollen Y, Hageman JH, van Leenen P, Derks LLM, Ponsioen B, Buissant des Amorie JR, Verlaan-Klink I, van den Bos M, Terstappen LWMM, van Boxtel R, Snippert HJG. PLoS Biol. 2022 Jan 28;20(1):e3001527. doi: 10.1371/journal.pbio.3001527. 10.1371/journal.pbio.3001527 PubMed 35089911