PGK+ plasmid with onboard mCherry cassette
(Plasmid
#169745)
-
PurposePGK+ plasmid that also encodes separate mCherry cassette. mCherry is used to monitor plasmid dosage.
-
Depositing Lab
-
Depositing OrganizationBaylor College of Medicine
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 169745 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 169745-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 169745-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA5/FRT
- Backbone size w/o insert (bp) 8535
- Total vector size (bp) 9257
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameeGFP
-
SpeciesSynthetic
- Promoter PGK-tetO2
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cattctgcacgcttcaaaag
- 3′ sequencing primer ggcaactagaaggcacagtc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 169745-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 169745-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PGK+ plasmid with onboard mCherry cassette was a gift from Francois St-Pierre (Addgene plasmid # 169745 ; http://n2t.net/addgene:169745 ; RRID:Addgene_169745) -
For your References section:
A synthetic circuit for buffering gene dosage variation between individual mammalian cells. Yang J, Lee J, Land MA, Lai S, Igoshin OA, St-Pierre F. Nat Commun. 2021 Jul 5;12(1):4132. doi: 10.1038/s41467-021-23889-0. 10.1038/s41467-021-23889-0 PubMed 34226556
