PGK+ plasmid with onboard mCherry cassette
(Plasmid
#169745)
-
PurposePGK+ plasmid that also encodes separate mCherry cassette. mCherry is used to monitor plasmid dosage.
-
Depositing Lab
-
Depositing OrganizationBaylor College of Medicine
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 169745 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA5/FRT
- Backbone size w/o insert (bp) 8535
- Total vector size (bp) 9257
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameeGFP
-
SpeciesSynthetic
- Promoter PGK-tetO2
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cattctgcacgcttcaaaag
- 3′ sequencing primer ggcaactagaaggcacagtc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PGK+ plasmid with onboard mCherry cassette was a gift from Francois St-Pierre (Addgene plasmid # 169745 ; http://n2t.net/addgene:169745 ; RRID:Addgene_169745) -
For your References section:
A synthetic circuit for buffering gene dosage variation between individual mammalian cells. Yang J, Lee J, Land MA, Lai S, Igoshin OA, St-Pierre F. Nat Commun. 2021 Jul 5;12(1):4132. doi: 10.1038/s41467-021-23889-0. 10.1038/s41467-021-23889-0 PubMed 34226556