PGK+ episome
(Plasmid
#170041)
-
PurposePGK+ circuit on an episomal vector. This plasmid encodes eGFP to report circuit output levels. This plasmid also encodes a separate mCherry expression cassette to monitor plasmid dosage.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 170041 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCEP4
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 13043
- Total vector size (bp) 13763
-
Modifications to backboneTetO2 site and rabbit beta-globin intron II (bGlob intron) are added to the 5' UTR. Woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) is added to the 3' UTR. This plasmid also has a separate mCherry expression cassette: EF1a promoter-mCherry-rbGlob terminator.
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameeGFP
-
Insert Size (bp)720
- Promoter PGK-tetO2
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctgggtacccggggatc
- 3′ sequencing primer gcaatagcatcacaaatttc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note the OriP sequence contains a deletion that is also found in Addgene plasmid (pCEP4-CXCR4) which was used as the backbone.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PGK+ episome was a gift from Francois St-Pierre (Addgene plasmid # 170041 ; http://n2t.net/addgene:170041 ; RRID:Addgene_170041) -
For your References section:
A synthetic circuit for buffering gene dosage variation between individual mammalian cells. Yang J, Lee J, Land MA, Lai S, Igoshin OA, St-Pierre F. Nat Commun. 2021 Jul 5;12(1):4132. doi: 10.1038/s41467-021-23889-0. 10.1038/s41467-021-23889-0 PubMed 34226556