pBZ186-pU6-(BbsI)_CBh-sv40NLS-Cas9-NLS T2A-mCherry
(Plasmid
#170182)
-
PurposeMammalian expression vector for sgRNAs cloned into the BbsI sites and for expression of spCas9 linked to mCherry via a T2A peptide
-
Depositing Lab
-
Depositing OrganizationStanford University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 170182 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneAddgene Plasmid #64323
-
Backbone manufacturerKuehn lab
-
Modifications to backboneVector was digested by NheI and BsrGI, mCherry was amplified from Addgene plasmid # 60954 (Weissman lab) and inserted into the digested vector backbone by Gibson assembly.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry
- Promoter CBh
-
Tags
/ Fusion Proteins
- 3XFlag (N terminal on backbone)
- T2A (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer acggatcgacctgtctcagc
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGenes encoding SpCas9 was obtained from previously reported plasmids (Addgene plasmid # 64323, Ralf Kühn lab); mCherry was amplified from Addgene plasmid # 60954 (Jonathan Weissman lab)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBZ186-pU6-(BbsI)_CBh-sv40NLS-Cas9-NLS T2A-mCherry was a gift from Hunter Fraser (Addgene plasmid # 170182 ; http://n2t.net/addgene:170182 ; RRID:Addgene_170182) -
For your References section:
Bacterial Retrons Enable Precise Gene Editing in Human Cells. Zhao B, Chen SA, Lee J, Fraser HB. CRISPR J. 2022 Jan 24. doi: 10.1089/crispr.2021.0065. 10.1089/crispr.2021.0065 PubMed 35076284