Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBZ210-pU6-sgBFP-An_CBh-sv40NLS-Cas9-Ec86RT-NLS-T2A-mCherry
(Plasmid #170185)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170185 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBZ191-pU6-sgBFP-CBh-sv40NLS-Cas9-NLS-T2A-mCherry
  • Backbone manufacturer
    Fraser lab
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Ec86 RT
  • Alt name
    RT-Sau1
  • Species
    Escherichia coli
  • Promoter CBh
  • Tag / Fusion Protein
    • NLS (C terminal on backbone)

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    Retron Ec86 msr-msd
  • Alt name
    Retron Eco1 msr-msd
  • Species
    Escherichia coli
  • Promoter hU6

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • 3′ sequencing primer acttgatgtactgccaagtg
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    BFP-to-GFP conversion donor template An
  • Promoter hU6

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • 3′ sequencing primer acttgatgtactgccaagtg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBZ210-pU6-sgBFP-An_CBh-sv40NLS-Cas9-Ec86RT-NLS-T2A-mCherry was a gift from Hunter Fraser (Addgene plasmid # 170185 ; http://n2t.net/addgene:170185 ; RRID:Addgene_170185)
  • For your References section:

    Bacterial Retrons Enable Precise Gene Editing in Human Cells. Zhao B, Chen SA, Lee J, Fraser HB. CRISPR J. 2022 Jan 24. doi: 10.1089/crispr.2021.0065. 10.1089/crispr.2021.0065 PubMed 35076284