Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #105842)


Item Catalog # Description Quantity Price (USD)
Plasmid 105842 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 14168
  • Modifications to backbone
    CLYBL homology arms
  • Vector type
  • Selectable markers
    Puromycin ; SBP-LNGFR for bead selection

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Neurogenin 2
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    NEUROG2 (a.k.a. Atoh4, Math4A, NGN2, bHLHa8, ngn-2)
  • Promoter TRE3G

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    ISL LIM Homeobox 1
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    ISL1 (a.k.a. ISLET1, Isl-1)
  • Promoter TRE3G

Cloning Information for Gene/Insert 2

Gene/Insert 3

  • Gene/Insert name
    LIM Homeobox 3
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Promoter TRE3G

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CAGCATGGTAGCCAGTCCTATTG
  • 3′ sequencing primer TGTGGAATTGTGAGCGGATA
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    Optimized mApple
  • Alt name
    Optimized mApple
  • Species
  • Insert Size (bp)
  • Promoter EF-1alpha

Cloning Information for Gene/Insert 4

Gene/Insert 5

  • Gene/Insert name
  • Alt name
  • Insert Size (bp)
  • Promoter CAG

Cloning Information for Gene/Insert 5

Gene/Insert 6

  • Gene/Insert name
    SBP Delta-LNGFR
  • Alt name
    SBP Delta-LNGFR
  • Insert Size (bp)
  • Promoter EF-1alpha

Cloning Information for Gene/Insert 6

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CLYBL-(Ef1a-SBP-LNGFR-T2A-mApple)-(CAG-rtTA)-(TRE-hNIL)) was a gift from Michael Ward (Addgene plasmid # 105842 ; ; RRID:Addgene_105842)
  • For your References section:

    Transcription Factor-Mediated Differentiation of Human iPSCs into Neurons. Fernandopulle MS, Prestil R, Grunseich C, Wang C, Gan L, Ward ME. Curr Protoc Cell Biol. 2018 Jun;79(1):e51. doi: 10.1002/cpcb.51. Epub 2018 May 18. 10.1002/cpcb.51 PubMed 29924488