pUCM-CLYBL-hNIL
(Plasmid #105841)

• Purpose: Donor construct for introduction of hNIL factors to CLYBL safe harbor site and iPSC differentiation to motor neuron
• Depositing Lab: Michael Ward
• Publication: Fernandopulle et al Curr Protoc Cell Biol. 2018 Jun;79(1):e51. doi: 10.1002/cpcb.51. Epub 2018 May 18.

Backbone

• Vector backbone: pUCM
• Backbone manufacturer: custom
• Backbone size w/o insert (bp): 6000
• Total vector size (bp): 13284
• Vector type: CRISPR, TALEN
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Neurogenin 2
• Alt name: NGN2
• Species: H. sapiens (human)
• Insert Size (bp): 819
• GenBank ID: NM_024019
• Entrez Gene: NEUROG2 (a.k.a. Atoh4, Math4A, NGN2, bHLHa8, ngn-2)
• Promoter: TRE3G

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCTCGTTTAGTGAACCGTCAG

Gene/Insert 2

• Gene/Insert name: ISL LIM Homeobox 1
• Alt name: ISL1
• Species: H. sapiens (human)
• Insert Size (bp): 1050
• GenBank ID: NM_002202
• Entrez Gene: ISL1 (a.k.a. ISLET1, Isl-1)
• Promoter: TRE3G

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CAGCCTGCTGAAGCAGGCTGG

Gene/Insert 3

• Gene/Insert name: LIM Homeobox 3
• Alt name: LHX3
• Species: H. sapiens (human)
• Insert Size (bp): 1209
• Promoter: TRE3G

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CAGCATGGTAGCCAGTCCTATTG
• 3′ sequencing primer: TGTGGAATTGTGAGCGGATA

Gene/Insert 4

• Gene/Insert name: mCherry
• Alt name: mcherry
• Species: Synthetic
• Insert Size (bp): 702
• Promoter: EF-1alpha

Cloning Information for Gene/Insert 4

• Cloning method: Unknown
• 5′ sequencing primer: gcgcctacgctagcgctac

Gene/Insert 5

• Gene/Insert name: rtTA3G
• Alt name: rtTA3G
• Insert Size (bp): 747
• Promoter: CAG

Cloning Information for Gene/Insert 5

• Cloning method: Unknown
• 5′ sequencing primer: ctggttattgtgctgtctc

Resource Information

• Supplemental Documents:
  • pUCM-CYBL-hNIL.gb
• A portion of this plasmid was derived from a plasmid made by: Tre3G and rTTA are from Clontech Plasmid (TetOne Lenti Vector)
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry