-
PurposeDonor construct for introduction of NGN2 into AAVS1 safe harbor site and iPSC differentiation to cortical neuron
-
Depositing Lab
-
Depositing OrganizationNational Institute of Neurological Disorders and Strokes (NINDS)
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 105840 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 105840-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 105840-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepUCM
-
Backbone manufacturercustom
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 10618
-
Modifications to backboneAAVS1 homology arms
-
Vector typeCRISPR, TALEN
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameNeurogenin 2
-
Alt nameNGN2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)819
-
GenBank IDNM_024019
-
Entrez GeneNEUROG2 (a.k.a. Atoh4, Math4A, NGN2, bHLHa8, ngn-2)
- Promoter TRE3G
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTCGTTTAGTGAACCGTCAG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemCherry
-
Alt namemcherry
-
SpeciesSynthetic
-
Insert Size (bp)702
- Promoter EF-1alpha
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer gcgcctacgctagcgctac
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namertTA3G
-
Alt namertTA3G
-
Insert Size (bp)747
- Promoter CAG
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer ctggttattgtgctgtctc
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byTre3G and rTTA are from Clontech Plasmid (TetOne Lenti Vector)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that this plasmid may runs as a dimer (>21kb). Concatenation/Dimerization often does not impact plasmid function, but may reduce transformation efficiencies. You may need to screen multiple colonies to isolate the monomeric version of this plasmid. If you still have trouble isolating the monomeric version, you might consider linearizing, gel extracting, re-ligating, and transforming the plasmid.
DNA (Catalog # 105840-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 105840-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUCM-AAVS1-TO-hNGN2 was a gift from Michael Ward (Addgene plasmid # 105840 ; http://n2t.net/addgene:105840 ; RRID:Addgene_105840) -
For your References section:
Transcription Factor-Mediated Differentiation of Human iPSCs into Neurons. Fernandopulle MS, Prestil R, Grunseich C, Wang C, Gan L, Ward ME. Curr Protoc Cell Biol. 2018 Jun;79(1):e51. doi: 10.1002/cpcb.51. Epub 2018 May 18. 10.1002/cpcb.51 PubMed 29924488