pUPD2+pG10-90
(Plasmid #170879)

• Purpose: Phytobrick - pG10-90
• Depositing Lab: Markita Landry
• Publication: Gonzalez-Grandio et al ACS Synth Biol. 2021 Sep 14. doi: 10.1021/acssynbio.1c00248.

Backbone

• Vector backbone: pUPD2
• Backbone manufacturer: Diego Orzaez Lab
• Backbone size w/o insert (bp): 2105
• Vector type: Plant Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: pG10-90
• Alt name: G10-90 synthetic promoter
• Species: Synthetic
• Insert Size (bp): 247

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Esp3I (destroyed during cloning)
• 3′ cloning site: Esp3I (destroyed during cloning)
• 5′ sequencing primer: ATAGGCGTATCACGAGGCAG
• 3′ sequencing primer: CGAGTCAGTGAGCGAGGAAG

Resource Information

• Supplemental Documents:
  • 007 - pUPD2+pG10-90.gb
• A portion of this plasmid was derived from a plasmid made by: Original promoter from https://doi.org/10.1046/j.1365-313X.1999.00456.x

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Insert can be excised by BsaI digestion . Please visit https://www.biorxiv.org/content/10.1101/2021.05.26.443018v2 to read the preprint on bioRxiv