Skip to main content
Holiday Schedule: Addgene will be closed November 24th & 25th for the Thanksgiving Holiday. Order processing and shipping may be delayed during this week. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-Ef1a-fDIO-ChrimsonR-tdTomato
(Plasmid #171027)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 171027 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-Ef1a-fDIO
  • Backbone manufacturer
    Addgene # 55641
  • Backbone size w/o insert (bp) 6323
  • Modifications to backbone
    EYFP cDNA removed by AscI-NheI double digest
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ChrimsonR-tdTomato
  • Species
    Synthetic
  • Insert Size (bp)
    2496
  • Promoter Ef1a
  • Tag / Fusion Protein
    • ChrimsonR is fused to tdTomato (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NheI (destroyed during cloning)
  • 5′ sequencing primer GTTAGGCCAGCTTGGCACTTGATG
  • 3′ sequencing primer CAAAGGCATTAAAGCAGCGTATCC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    ChrimsonR-tdTomato fusion was isolated from Addgene #62723

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Ef1a-fDIO-ChrimsonR-tdTomato was a gift from Patricia Jensen (Addgene plasmid # 171027 ; http://n2t.net/addgene:171027 ; RRID:Addgene_171027)
  • For your References section:

    Natural locus coeruleus dynamics during feeding. Sciolino NR, Hsiang M, Mazzone CM, Wilson LR, Plummer NW, Amin J, Smith KG, McGee CA, Fry SA, Yang CX, Powell JM, Bruchas MR, Kravitz AV, Cushman JD, Krashes MJ, Cui G, Jensen P. Sci Adv. 2022 Aug 19;8(33):eabn9134. doi: 10.1126/sciadv.abn9134. Epub 2022 Aug 19. 10.1126/sciadv.abn9134 PubMed 35984878