pCRISPaint-mScarlet-PuroR [M1G]
(Plasmid
#171809)
-
PurposeUniversal donor plasmid for CRISPitope method encoding mScarlet fluorescent protein and puromycin resistance cassette [p.M1G]
-
Depositing Lab
-
Depositing OrganizationUniversitaetsklinikum Bonn
Located in Germany -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171809 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 171809-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 171809-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCRISPaint
-
Backbone manufacturerBased on plasmids published by Schmid-Burgk et al. 2016 (DOI: 10.1038/ncomms12338)
- Backbone size w/o insert (bp) 2542
- Total vector size (bp) 3898
-
Vector typeGene tagging
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemScarlet-T2A-PuroR
-
SpeciesDiscosoma sp., Streptomyces alboniger
-
Insert Size (bp)1356
-
MutationPuroR: Changed Methionin 1 to Glycine.
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer CGATAGTACTAACATACGCTCTCCA
- 3′ sequencing primer CTCCCCCTGAACCTGAAAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 171809-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 171809-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPaint-mScarlet-PuroR [M1G] was a gift from Michael Hoelzel (Addgene plasmid # 171809 ; http://n2t.net/addgene:171809 ; RRID:Addgene_171809) -
For your References section:
Adoptive T Cell Therapy Targeting Different Gene Products Reveals Diverse and Context-Dependent Immune Evasion in Melanoma. Effern M, Glodde N, Braun M, Liebing J, Boll HN, Yong M, Bawden E, Hinze D, van den Boorn-Konijnenberg D, Daoud M, Aymans P, Landsberg J, Smyth MJ, Flatz L, Tuting T, Bald T, Gebhardt T, Holzel M. Immunity. 2020 Sep 15;53(3):564-580.e9. doi: 10.1016/j.immuni.2020.07.007. Epub 2020 Aug 3. 10.1016/j.immuni.2020.07.007 PubMed 32750334