pGL3-Promoter-hPE(+)-Luc
(Plasmid
#172003)
-
PurposeLuciferase Reporter for Human PTEN Enhancer PE - Forward Orientation
-
Depositing Lab
-
Depositing OrganizationRutgers, The State University of New Jersey
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 172003 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 172003-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 172003-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGL3-Promoter
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5010
- Total vector size (bp) 9374
-
Vector typeMammalian Expression, Bacterial Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHuman PE sequence (hPE)
-
Alt nameHuman PTEN Enhancer sequence (hPE)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4364
- Promoter SV40 Promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer agtactaacatacgctctcc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 172003-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 172003-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-Promoter-hPE(+)-Luc was a gift from Daniel Herranz (Addgene plasmid # 172003 ; http://n2t.net/addgene:172003 ; RRID:Addgene_172003) -
For your References section:
A Tumor Suppressor Enhancer of PTEN in T-cell development and leukemia. Tottone L, Lancho O, Loh JW, Singh A, Kimura S, Roels J, Kuchmiy A, Strubbe S, Lawlor MA, da Silva-Diz V, Luo S, Gachet S, Garcia-Prieto CA, Hagelaar R, Esteller M, Meijerink JPP, Soulier J, Taghon T, Van Vlierberghe P, Mullighan CG, Khiabanian H, Rocha PP, Herranz D. Blood Cancer Discov. 2021 Jan;2(1):92-109. doi: 10.1158/2643-3230.BCD-20-0201. Epub 2020 Nov 24. 10.1158/2643-3230.BCD-20-0201 PubMed 33458694
Map uploaded by the depositor.
