pTwist-FLAG-SRSF3_Truncated_Codon.Optimized
(Plasmid
#172346)
-
PurposeExpression of FLAG-tagged, codon-optimized, truncated SRSF3
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 172346 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepTwist
-
Backbone manufacturerTwist Bioscience
- Backbone size w/o insert (bp) 4843
- Total vector size (bp) 5245
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameserine and arginine rich splicing factor 3
-
Alt nameSRSF3 (codon-optimized, truncated)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)402
-
Mutationcodon-optimized, truncated at amino acid 114 with a novel 10 amino acid C-terminal extension
-
GenBank IDNR_036610.2
-
Entrez GeneSRSF3 (a.k.a. SFRS3, SRp20)
- Promoter EF-1a
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTwist-FLAG-SRSF3_Truncated_Codon.Optimized was a gift from Sujatha Jagannathan (Addgene plasmid # 172346 ; http://n2t.net/addgene:172346 ; RRID:Addgene_172346) -
For your References section:
Compromised nonsense-mediated RNA decay results in truncated RNA-binding protein production upon DUX4 expression. Campbell AE, Dyle MC, Albanese R, Matheny T, Sudheendran K, Cortazar MA, Forman T, Fu R, Gillen AE, Caruthers MH, Floor SN, Calviello L, Jagannathan S. Cell Rep. 2023 Jun 13;42(6):112642. doi: 10.1016/j.celrep.2023.112642. 10.1016/j.celrep.2023.112642 PubMed 37314931