PB-HD118
(Plasmid
#172655)
-
PurposeExpressing paired pegRNAs from human U6 and H1 promoters to make 118-bp deletion on HPRT1 gene
-
Depositing Lab
-
Depositing OrganizationUniversity of Washington
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 172655 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 172655-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 172655-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepiggyBAC-U6-BlastR
-
Vector typeCRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepegRNA-HD118A/pegRNA-HD118B
-
gRNA/shRNA sequenceunspecified
-
SpeciesSynthetic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer GACTATCATATGCTTACCGT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.12.30.424891v1 for bioRxiv preprint.
DNA (Catalog # 172655-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 172655-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-HD118 was a gift from Jay Shendure (Addgene plasmid # 172655 ; http://n2t.net/addgene:172655 ; RRID:Addgene_172655) -
For your References section:
Precise genomic deletions using paired prime editing. Choi J, Chen W, Suiter CC, Lee C, Chardon FM, Yang W, Leith A, Daza RM, Martin B, Shendure J. Nat Biotechnol. 2021 Oct 14. pii: 10.1038/s41587-021-01025-z. doi: 10.1038/s41587-021-01025-z. 10.1038/s41587-021-01025-z PubMed 34650269
