pJET1.2-U6
(Plasmid #173157)

• Purpose: Single guide RNA cassette under U6 promoter
• Depositing Lab: Piotr Ziolkowski
• Publication: Bieluszewski et al Nat Commun. 2022 Jan 12;13(1):277. doi: 10.1038/s41467-021-27882-5.

Backbone

• Vector backbone: pJet1.2
• Backbone manufacturer: Thermo Scientific
• Backbone size w/o insert (bp): 2974
• Total vector size (bp): 3837
• Vector type: Plant Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: sgRNA cassette under U6 promoter
• gRNA/shRNA sequence: (G)CTCGCACTAGTGAACCCCAG
• Species: A. thaliana (mustard weed)
• GenBank ID: 832208
• Promoter: AtU6-26

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: TAA TAC GAC TCA CTA TAG GG
• 3′ sequencing primer: ATT AAC CCT CAC TAA AGG GA

Resource Information

• Supplemental Documents:
  • AtU6-26gRNA-pJET.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This vector was designed and constructed by Dr. Tomasz Bieluszewski.

Detailed protocol for CRISPR/Cas9-based mutagenesis using this system in:
Bieluszewski T, Szymanska-Lejman M, Dziegielewski W, Zhu L, Ziolkowski PA. Efficient Generation of CRISPR/Cas9-Based Mutants Supported by Fluorescent Seed Selection in Different Arabidopsis Accessions, in: Plant Gametogenesis: Methods and Protocols (ed. Christophe Lambing), Methods in Molecular Biology, vol. 2484.
https://doi.org/10.1007/978-1-0716-2253-7_13
https://pubmed.ncbi.nlm.nih.gov/35461452/