pClgn1.1_Kctd19-3xHA
(Plasmid #173497)

• Purpose: Express Kctd19-3xHA under the mouse Clgn promoter.
• Depositing Lab: Masahito Ikawa
• Publication: Oura et al PLoS Genet. 2021 May 7;17(5):e1009412. doi: 10.1371/journal.pgen.1009412. eCollection 2021 May.

Backbone

• Vector backbone: pClgn1.1
• Backbone size w/o insert (bp): 3793
• Total vector size (bp): 6683
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Potassium Channel Tetramerization Domain Containing 19
• Alt name: Kctd19
• Species: M. musculus (mouse)
• Insert Size (bp): 2898
• Entrez Gene: Kctd19 (a.k.a. 4922504H04Rik)
• Tag / Fusion Protein:
  • HA

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: ttgagcgggccgcttgcgcactgg
• 3′ sequencing primer: gccacaccagccaccaccttctg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry