Skip to main content

VAMP4-SEP
(Plasmid #174406)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174406 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 174406-D50 50 μg of DNA in Tris buffer $495
DNA 174406-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCMV
  • Total vector size (bp) 5878
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    vesicle associated membrane protein 4
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_003762
  • Entrez Gene
    VAMP4 (a.k.a. VAMP-4, VAMP24)
  • Promoter CMV
  • Tag / Fusion Protein
    • superecliptic phulorin (mutated GFP) (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CTCACGGGGATTTCCAAGTCTCCACCCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Lab of Thierry Galli (IPNP Paris, France)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    VAMP4-SEP was a gift from David Perrais (Addgene plasmid # 174406 ; http://n2t.net/addgene:174406 ; RRID:Addgene_174406)
  • For your References section:

    The vSNAREs VAMP2 and VAMP4 control recycling and intracellular sorting of post-synaptic receptors in neuronal dendrites. Bakr M, Jullie D, Krapivkina J, Paget-Blanc V, Bouit L, Petersen JD, Retailleau N, Breillat C, Herzog E, Choquet D, Perrais D. Cell Rep. 2021 Sep 7;36(10):109678. doi: 10.1016/j.celrep.2021.109678. 10.1016/j.celrep.2021.109678 PubMed 34496238