VAMP4-SEP
(Plasmid
#174406)
-
PurposeReporter for VAMP4 exocytosis in mammalian cells
-
Depositing Lab
-
Depositing OrganizationCNRS UMR 5297, Institut Interdisciplinaire de Neurosciences (IINS)
Located in France -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 174406 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 174406-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 174406-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCMV
- Total vector size (bp) 5878
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namevesicle associated membrane protein 4
-
SpeciesH. sapiens (human)
-
GenBank IDNM_003762
-
Entrez GeneVAMP4 (a.k.a. VAMP-4, VAMP24)
- Promoter CMV
-
Tag
/ Fusion Protein
- superecliptic phulorin (mutated GFP) (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CTCACGGGGATTTCCAAGTCTCCACCCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byLab of Thierry Galli (IPNP Paris, France)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 174406-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 174406-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VAMP4-SEP was a gift from David Perrais (Addgene plasmid # 174406 ; http://n2t.net/addgene:174406 ; RRID:Addgene_174406) -
For your References section:
The vSNAREs VAMP2 and VAMP4 control recycling and intracellular sorting of post-synaptic receptors in neuronal dendrites. Bakr M, Jullie D, Krapivkina J, Paget-Blanc V, Bouit L, Petersen JD, Retailleau N, Breillat C, Herzog E, Choquet D, Perrais D. Cell Rep. 2021 Sep 7;36(10):109678. doi: 10.1016/j.celrep.2021.109678. 10.1016/j.celrep.2021.109678 PubMed 34496238
Map uploaded by the depositor.
