CMV-IgK-pHluorin-TM-mRuby
(Plasmid
#185546)
-
PurposeExpresses surface-localized pHluorin fused to intracellular expression of mRuby under CMV promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 185546 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCMV
- Total vector size (bp) 6726
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIgK-pHluorin-TM-mRuby
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1680
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site BlpI (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.07.03.498586v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-IgK-pHluorin-TM-mRuby was a gift from Jaime de Juan-Sanz (Addgene plasmid # 185546 ; http://n2t.net/addgene:185546 ; RRID:Addgene_185546) -
For your References section:
Activity-driven synaptic translocation of LGI1 controls excitatory neurotransmission. Cuhadar U, Calzado-Reyes L, Pascual-Caro C, Aberra AS, Ritzau-Jost A, Aggarwal A, Ibata K, Podgorski K, Yuzaki M, Geis C, Hallerman S, Hoppa MB, de Juan-Sanz J. Cell Rep. 2024 May 28;43(5):114186. doi: 10.1016/j.celrep.2024.114186. Epub 2024 May 2. 10.1016/j.celrep.2024.114186 PubMed 38700985