VAMP4-SEP
(Plasmid
#174406)
-
PurposeReporter for VAMP4 exocytosis in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 174406 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV
- Total vector size (bp) 5878
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namevesicle associated membrane protein 4
-
SpeciesH. sapiens (human)
-
GenBank IDNM_003762
-
Entrez GeneVAMP4 (a.k.a. VAMP-4, VAMP24)
- Promoter CMV
-
Tag
/ Fusion Protein
- superecliptic phulorin (mutated GFP) (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CTCACGGGGATTTCCAAGTCTCCACCCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byLab of Thierry Galli (IPNP Paris, France)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VAMP4-SEP was a gift from David Perrais (Addgene plasmid # 174406 ; http://n2t.net/addgene:174406 ; RRID:Addgene_174406) -
For your References section:
The vSNAREs VAMP2 and VAMP4 control recycling and intracellular sorting of post-synaptic receptors in neuronal dendrites. Bakr M, Jullie D, Krapivkina J, Paget-Blanc V, Bouit L, Petersen JD, Retailleau N, Breillat C, Herzog E, Choquet D, Perrais D. Cell Rep. 2021 Sep 7;36(10):109678. doi: 10.1016/j.celrep.2021.109678. 10.1016/j.celrep.2021.109678 PubMed 34496238