Skip to main content

eSpCas9-EF-5Pou5f1
(Plasmid #174872)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174872 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 174872-D50 50 μg of DNA in Tris buffer $495
DNA 174872-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    eSpCas9(1.1)
  • Backbone manufacturer
    Feng Zhang
  • Total vector size (bp) 8519
  • Modifications to backbone
    We applied an optimized sgRNA design (sgRNA(F+E)) (Chen et al., Cell, 2013).
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA for mouse Pou5f1
  • Alt name
    Pou5f1 (Mus musculus)
  • gRNA/shRNA sequence
    CCAACTTCACGGCATTGGGG
  • Species
    Synthetic
  • GenBank ID
  • Entrez Gene
    Pou5f1 (a.k.a. NF-A3, Oct-3, Oct-3/4, Oct-4, Oct3, Oct3/4, Oct4, Otf-3, Otf-4, Otf3, Otf3-rs7, Otf3g, Otf4)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer LKO1_5_primer
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    eSpCas9-EF-5Pou5f1 was a gift from Hiroshi Ochiai (Addgene plasmid # 174872 ; http://n2t.net/addgene:174872 ; RRID:Addgene_174872)
  • For your References section:

    STREAMING-tag system reveals spatiotemporal relationships between transcriptional regulatory factors and transcriptional activity. Ohishi H, Shimada S, Uchino S, Li J, Sato Y, Shintani M, Owada H, Ohkawa Y, Pertsinidis A, Yamamoto T, Kimura H, Ochiai H. Nat Commun. 2022 Dec 20;13(1):7672. doi: 10.1038/s41467-022-35286-2. 10.1038/s41467-022-35286-2 PubMed 36539402