px459 sgAtg5
(Plasmid
#175023)
-
PurposeCRISPR-Cas9 plasmid targeting exon 2 of human Atg5.
-
Depositing Lab
-
Depositing OrganizationUniversity of Southampton
Located in the United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 175023 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 175023-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 175023-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepx459
- Backbone size w/o insert (bp) 9174
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameATG5
-
gRNA/shRNA sequenceAAGATGTGCTTCGAGATGTG
-
SpeciesH. sapiens (human)
-
GenBank IDNM_004849.4
-
Entrez GeneATG5 (a.k.a. APG5, APG5-LIKE, APG5L, ASP, SCAR25, hAPG5)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer U6 FWD
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 175023-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 175023-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
px459 sgAtg5 was a gift from David Tumbarello (Addgene plasmid # 175023 ; http://n2t.net/addgene:175023 ; RRID:Addgene_175023) -
For your References section:
Loss of the Essential Autophagy Regulators FIP200 or Atg5 Leads to Distinct Effects on Focal Adhesion Composition and Organization. Assar EA, Tumbarello DA. Front Cell Dev Biol. 2020 Aug 4;8:733. doi: 10.3389/fcell.2020.00733. eCollection 2020. 10.3389/fcell.2020.00733 PubMed 32850845