Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #104321)


Item Catalog # Description Quantity Price (USD)
Plasmid 104321 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size (bp) 8800
  • Modifications to backbone
    shRNA encoding to sgRNA encoding
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Promoter H1/TO
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer tet-pLKO-seq-1: 5’- GTTTCAGACCCACCTCCCAAC’-3
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    tet-pLKO-sgRNA-puro was a gift from Nathanael Gray (Addgene plasmid # 104321 ; ; RRID:Addgene_104321)
  • For your References section:

    MELK is not necessary for the proliferation of basal-like breast cancer cells. Huang HT, Seo HS, Zhang T, Wang Y, Jiang B, Li Q, Buckley DL, Nabet B, Roberts JM, Paulk J, Dastjerdi S, Winter GE, McLauchlan H, Moran J, Bradner JE, Eck MJ, Dhe-Paganon S, Zhao JJ, Gray NS. Elife. 2017 Sep 19;6. pii: e26693. doi: 10.7554/eLife.26693. 10.7554/eLife.26693 PubMed 28926338