Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

FgH1tUTG
(Plasmid #70183)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 70183 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    FUGW
  • Backbone manufacturer
    David Baltimore
  • Backbone size w/o insert (bp) 9940
  • Total vector size (bp) 10900
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    H1-Tet-sgrna cassette
  • gRNA/shRNA sequence
    TTAATTAACCATGGAATTCGAACGCTGACGTCATCAACCCGCTCCAAGGAATCGCGGGCCCAGTGTCACTAGGCGGGAACACCCAGCGCGCGTGCGCCCTGGCAGGAAGATGGCTGTGAGGGACAGGGGAGTGGCGCCCTGCAATATTTGCATGTCGCTATGTGTTCTGGGAAATCACCATAAACGTGAAATGTCTTTGGATTTGGGAATCTTATAAGTCCCTATCAGTGATAGAGATTCCCGGAGACGGACGTCTCGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTTTAATTAA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Pac 1 (not destroyed)
  • 3′ cloning site Pac1 (not destroyed)
  • 5′ sequencing primer CAGACATACAAACTAAAGAAT
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FgH1tUTG was a gift from Marco Herold (Addgene plasmid # 70183 ; http://n2t.net/addgene:70183 ; RRID:Addgene_70183)
  • For your References section:

    An inducible lentiviral guide RNA platform enables the identification of tumor-essential genes and tumor-promoting mutations in vivo. Aubrey BJ, Kelly GL, Kueh AJ, Brennan MS, O'Connor L, Milla L, Wilcox S, Tai L, Strasser A, Herold MJ. Cell Rep. 2015 Mar 3;10(8):1422-32. doi: 10.1016/j.celrep.2015.02.002. Epub 2015 Feb 26. 10.1016/j.celrep.2015.02.002 PubMed 25732831