Skip to main content

pEF1a_HH-EMX1 spacer-gRNA scaffold-EC73-5'-donor template-EC73-3'-HDV_pA_pCMV_EGFP-L138S-P2A-mCherry_pA
(Plasmid #176459)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176459 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 176459-D50 50 μg of DNA in Tris buffer $495
DNA 176459-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    piggyBac-EF1alpha
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HH-EMX1 spacer-gRNA scaffold-Ec73ncRNA-donor sequence-HDV
  • gRNA/shRNA sequence
    GAGTCCGAGCAGAAGAAGAA
  • Species
    Synthetic
  • Insert Size (bp)
    463
  • Promoter EF1alpha

Cloning Information

  • Cloning method Gibson Cloning

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid name in Yang lab: HGpl553

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEF1a_HH-EMX1 spacer-gRNA scaffold-EC73-5'-donor template-EC73-3'-HDV_pA_pCMV_EGFP-L138S-P2A-mCherry_pA was a gift from Hui Yang (Addgene plasmid # 176459 ; http://n2t.net/addgene:176459 ; RRID:Addgene_176459)
  • For your References section:

    Precise genome editing without exogenous donor DNA via retron editing system in human cells. Kong X, Wang Z, Zhang R, Wang X, Zhou Y, Shi L, Yang H. Protein Cell. 2021 Aug 17. pii: 10.1007/s13238-021-00862-7. doi: 10.1007/s13238-021-00862-7. 10.1007/s13238-021-00862-7 PubMed 34403072