pJP103
(Plasmid #176481)

• Purpose: Expresses mScarlet under control of the Capsaspora EF1 promoter and HygR under control of the Capsaspora actin promoter
• Depositing Lab: Duojia Pan
• Publication: Phillips et al Elife. 2022 Jun 6;11. pii: 77598. doi: 10.7554/eLife.77598.

Backbone

• Vector backbone: pUC57-mini
• Backbone manufacturer: Genscript
• Backbone size w/o insert (bp): 1835
• Total vector size (bp): 5133
• Modifications to backbone: To generate a vector for mScarlet expression in Capsaspora, a DNA construct containing an open reading frame encoding the mScarlet protein codon-optimized for expression in Capsaspora and under control of the EF1-α promoter and terminator was constructed by gene synthesis and cloned into the EcoRV site of the pUC57-mini vector (Genscript). A KpnI site and an AflII site were incorporated at the beginning and end of the coding sequence, respectively, allowing for the construction of N or C-terminal protein fusion constructs by Gibson assembly. To incorporate a Hygromycin resistance gene, the hygromycin B phosphotransferase coding sequence from the Dictyostelium pDM358 vector was codon optimized for Capsaspora, the optimized sequence was synthesized with the promoter and terminator from the Capsaspora actin ortholog gene CAOG_06018, and the synthesized fragment was cloned into the SmaI site of pUC-57 by Gibson assembly.
• Vector type: Capsaspora owczarzaki expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: actin > HygR
• Species: Synthetic; Capsaspora owczarzaki
• Insert Size (bp): 1328

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTTCCGCGCACATTTCC

Gene/Insert 2

• Gene/Insert name: EF1 > mScarlet
• Species: Synthetic; Capsaspora owczarzaki
• Insert Size (bp): 1952

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GATTTGGAAATGCTCACTCTTCC
• 3′ sequencing primer: TGAAATAAACAAATGTGTCTTGGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The EF-1 promoter sequence was provided as a gift by Dr. Iñaki Ruiz-trillo.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry