PiggyBac-TetO-En1-t2a-Foxa2-hygro
(Plasmid #176483)

• Purpose: TetO-En1-t2a-Foxa2 in a PiggyBac vector with hygromycin resistance
• Depositing Lab: Marius Wernig
• Publication: Ng et al Stem Cell Reports. 2021 Jul 13;16(7):1763-1776. doi: 10.1016/j.stemcr.2021.05.017. Epub 2021 Jun 24.

Backbone

• Vector backbone: Piggybac TetO - hygromycin
• Backbone size w/o insert (bp): 8621
• Total vector size (bp): 11294
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: The Wernig lab uses Stbl3 or JM109 for downstream applications.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: En1-t2a-FoxA2
• Species: H. sapiens (human), M. musculus (mouse)
• Insert Size (bp): 2673
• Entrez Gene: FOXA2 (a.k.a. HNF-3-beta, HNF3B, TCF3B)
• Entrez Gene: En1 (a.k.a. En-1, Mo-en.1, engrailed-1)
• Promoter: TetO

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: PacI (not destroyed)
• 5′ sequencing primer: TGACCTCCATAGAAGACACC
• 3′ sequencing primer: ggaggggcaaacaacagatg

Resource Information

• Supplemental Documents:
  • PiggyBac-TetO-En1-t2a-Foxa2-hygro.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry