pEPQD2KN0897
(Plasmid #177090)

• Purpose: MoClo Level 2 plasmid containing multiple transcriptional units for transient expression of CrISY, NmMLPL, Cr7-DLGT, CrGOR, CrIO, and CrG8H driven by 4x opaatB
• Depositing Lab: Nicola Patron
• Publication: Dudley et al Commun Biol. 2022 Sep 10;5(1):949. doi: 10.1038/s42003-022-03904-w.

Backbone

• Vector backbone: pICSL4723
• Vector type: Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CrISY, NmMLPL, Cr7-DLGT, CrGOR, CrIO, and CrG8H
• Alt name: L2 4X opattB middle iridiod cytosol v3
• Species: Other

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: GTGGTGTAAACAAATTGACGC
• 3′ sequencing primer: GGATAAACCTTTTCACGCCC

Resource Information

• Supplemental Documents:
  • pEPQD2KN0897.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

L2 4X opattB middle iridiod cytosol v3: P1_4X opattB-TMV-CrISY-35Sterm + P2_4X opattB-TMV-NmMLP-masterm + P3_4X opattB-TMV-Cr7DLGT-nosterm + P4_4X opattB-TMV-Cr8HGO/GOR-g7term + P5_4X opattB-TMV-CrIO-35Sterm + P6_4X opattB-TMV-CrG8H-ocsterm