pDAS12137_sgRNA-PEAR-GFP-nick(+17)-mCherry
(Plasmid
#177183)
-
Purposeplasmid expressing an sgRNA targeting the PEAR-GFP plasmid along with an mCherry marker
-
Depositing Lab
-
Depositing OrganizationHUN-REN Research Centre for Natural Sciences
Located in Hungary -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177183 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 177183-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 177183-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepUC19
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA targeting the PEAR-GFP plasmid
-
gRNA/shRNA sequencettcaagtccgccatgcccga
-
SpeciesSynthetic; S. pyogenes
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GAGGGCCTATTTCCCATGATT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Read the preprint at bioRxiv: https://www.biorxiv.org/content/10.1101/2021.04.26.441486v1.
DNA (Catalog # 177183-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 177183-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDAS12137_sgRNA-PEAR-GFP-nick(+17)-mCherry was a gift from Ervin Welker (Addgene plasmid # 177183 ; http://n2t.net/addgene:177183 ; RRID:Addgene_177183) -
For your References section:
PEAR, a flexible fluorescent reporter for the identification and enrichment of successfully prime edited cells. Simon DA, Talas A, Kulcsar PI, Biczok Z, Krausz SL, Varady G, Welker E. Elife. 2022 Feb 23;11. pii: 69504. doi: 10.7554/eLife.69504. 10.7554/eLife.69504 PubMed 35196219